LOCUS       GW395923                 436 bp    mRNA    linear   EST 01-FEB-2010
DEFINITION  RS- eng1(seg2) Different pathogenic populations of Radopholus
            similis SSH Library Radopholus similis cDNA similar to
            Endo-1,4-beta-glucanases, mRNA sequence.
ACCESSION   GW395923
VERSION     GW395923.1  GI:285016604
KEYWORDS    EST.
SOURCE      Radopholus similis
  ORGANISM  Radopholus similis
            Eukaryota; Metazoa; Nematoda; Chromadorea; Tylenchida; Tylenchina;
            Tylenchoidea; Pratylenchidae; Radopholinae; Radopholus.
REFERENCE   1  (bases 1 to 436)
  AUTHORS   Chao,Z. and Hui,X.
  TITLE     Characterization by suppression subtractive hybridization of
            transcripts that are expressed in different population of
            Radopholus similis
  JOURNAL   Unpublished
COMMENT     Contact: Chao, Z.; Hui, X.
            Department of Plant Pathology, Lab of Plant Nematology
            College of Natural Resources and Environment
            South China Agricultural University, 483 Wushan Road, Guangzhou,
            Guangdong 510642, P.R. China
            Tel: 0086-20-38297432
            Email: zhangchao1558@gmail.com
            PCR PRimers
            FORWARD: TAATACGACTCACTATAGGG
            BACKWARD: ATTTAGGTGACACTATAG
            Insert Length: 500   Std Error: 0.00
            Seq primer: T7 and SP6.
FEATURES             Location/Qualifiers
     source          1..436
                     /organism="Radopholus similis"
                     /mol_type="mRNA"
                     /strain="Nematode"
                     /db_xref="taxon:46012"
                     /sex="female"
                     /clone_lib="LIBEST_026026 Different pathogenic populations
                     of Radopholus similis SSH Library"
                     /dev_stage="Mixed"
                     /note="Vector: pGEM-T easy vector; Total RNA was isolated
                     from different developmental stages. The mRNA was
                     subsequently converted to double-stranded cDNA. After SSH
                     the PCR amplification products were cloned into the pGEM-T
                     vector. The ligation mixture was used to transform
                     Escherichia coli JM109 competent cells."
ORIGIN      
        1 gtactcggtc acgaacacgg gcaggccgtt gttcacagcg gtggtaacct tggagcggta
       61 ggaggcacca tgcgtggctg cgtagtagtg gaatgtgtac atgatgttgg agtagccggt
      121 gattgggttc gcggatgcga cttccacgtc ctgggaccat gtgggcgtgc cgcaaatgat
      181 gatgttgtcc gcgtcgttgg cgcgaatggc ggcaatcacc gccttgtggt atggcaccaa
      241 aacatccgtc cacgagacag aggtgggctc attgtaggtc tcgtacagca catgcgggta
      301 ggagccgtac gcagcggaca ccttggtgaa gaaggccacc gcgtcggact ggtaagtggc
      361 gctgacgtgc cagtccacga tcacgtagat accttgtgta atggccgcct caaccacggc
      421 aacgacgagc gcgtac
//