LOCUS       GW395922                 696 bp    mRNA    linear   EST 01-FEB-2010
DEFINITION  RS- eng1(seg1) Different pathogenic populations of Radopholus
            similis SSH Library Radopholus similis cDNA similar to
            Endo-1,4-beta-glucanases, mRNA sequence.
ACCESSION   GW395922
VERSION     GW395922.1  GI:285016605
KEYWORDS    EST.
SOURCE      Radopholus similis
  ORGANISM  Radopholus similis
            Eukaryota; Metazoa; Nematoda; Chromadorea; Tylenchida; Tylenchina;
            Tylenchoidea; Pratylenchidae; Radopholinae; Radopholus.
REFERENCE   1  (bases 1 to 696)
  AUTHORS   Chao,Z. and Hui,X.
  TITLE     Characterization by suppression subtractive hybridization of
            transcripts that are expressed in different population of
            Radopholus similis
  JOURNAL   Unpublished
COMMENT     Contact: Chao, Z.; Hui, X.
            Department of Plant Pathology, Lab of Plant Nematology
            College of Natural Resources and Environment
            South China Agricultural University, 483 Wushan Road, Guangzhou,
            Guangdong 510642, P.R. China
            Tel: 0086-20-38297432
            Email: zhangchao1558@gmail.com
            PCR PRimers
            FORWARD: TAATACGACTCACTATAGGG
            BACKWARD: ATTTAGGTGACACTATAG
            Insert Length: 1000   Std Error: 0.00
            Seq primer: T7 and SP6.
FEATURES             Location/Qualifiers
     source          1..696
                     /organism="Radopholus similis"
                     /mol_type="mRNA"
                     /strain="Nematode"
                     /db_xref="taxon:46012"
                     /sex="female"
                     /clone_lib="LIBEST_026026 Different pathogenic populations
                     of Radopholus similis SSH Library"
                     /dev_stage="Mixed"
                     /note="Vector: pGEM-T easy vector; Total RNA was isolated
                     from different developmental stages. The mRNA was
                     subsequently converted to double-stranded cDNA. After SSH
                     the PCR amplification products were cloned into the pGEM-T
                     vector. The ligation mixture was used to transform
                     Escherichia coli JM109 competent cells."
ORIGIN      
        1 gtacggcaca tgcgagtcgt cgggcagtgg cacaatcgac tcttcctcct cggccacttg
       61 gtggaccttc ttggatggac tgggaatctc ttacgtgaac tgggccatcg acaacaagga
      121 cgagacttgc gctgcgctca ccaccagcgg atccgcctcc accgtcggca gctcttccta
      181 ttggtccacg tcgggcaaac tggtcaacgc acaacaagtc gctaagagca acggagtgag
      241 ctgctcttcg tccgcgacca ctaccaccac cacgactaaa tctggagcgg ccaccactac
      301 caccaaggca tcggccacca ccactaccac caaggcctcg gccaccacta ccaccacaaa
      361 ggcttcttcg tcctcgtcga gttcagtgac cgcttcggtg tcgaccacca actcgtggag
      421 cggcggcagc caagtggcca tcacgttcaa gaactccggc tcctccagtg tgtgcaccat
      481 caagttcacg atcacactgc cgtccgggac caccatctcg agcatttgga acgccagtgt
      541 ggtcagcggc accacctaca cgacggccag ctacttcagt ctggcggccg gctcctccga
      601 cagctccatc ggaatggtgc tgaccggcag cggcactccc actgtctcaa ttgtgtccac
      661 cagtggatgc tgaatgtctg gcaggagatg aagtac
//